Review



shrna control plko 1 shctrl  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc shrna control plko 1 shctrl
    Shrna Control Plko 1 Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1473 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna control plko 1 shctrl/product/Addgene inc
    Average 96 stars, based on 1473 article reviews
    shrna control plko 1 shctrl - by Bioz Stars, 2026-06
    96/100 stars

    Images



    Similar Products

    96
    Addgene inc shrna control plko 1 shctrl
    Shrna Control Plko 1 Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna control plko 1 shctrl/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    shrna control plko 1 shctrl - by Bioz Stars, 2026-06
    96/100 stars
      Buy from Supplier

    90
    Millipore plko.1-hpgk-puro shctrl vector
    Plko.1 Hpgk Puro Shctrl Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko.1-hpgk-puro shctrl vector/product/Millipore
    Average 90 stars, based on 1 article reviews
    plko.1-hpgk-puro shctrl vector - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    96
    Addgene inc ted dawson rrid addgene 17608 plko 1 shctrl puro target sequence
    Ted Dawson Rrid Addgene 17608 Plko 1 Shctrl Puro Target Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ted dawson rrid addgene 17608 plko 1 shctrl puro target sequence/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    ted dawson rrid addgene 17608 plko 1 shctrl puro target sequence - by Bioz Stars, 2026-06
    96/100 stars
      Buy from Supplier

    93
    Addgene inc plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3
    Plko 1 Shctrl Puro Target Sequence 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars, 2026-06
    93/100 stars
      Buy from Supplier

    95
    Addgene inc control shrna against luciferase shctrl
    Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against <t>luciferase</t> or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of <t>SMMC7721-shCtrl</t> cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
    Control Shrna Against Luciferase Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control shrna against luciferase shctrl/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    control shrna against luciferase shctrl - by Bioz Stars, 2026-06
    95/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 shctrl puro
    Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against <t>luciferase</t> or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of <t>SMMC7721-shCtrl</t> cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
    Plko 1 Shctrl Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 shctrl puro/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    plko 1 shctrl puro - by Bioz Stars, 2026-06
    96/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 puro control shctrl
    Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against <t>luciferase</t> or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of <t>SMMC7721-shCtrl</t> cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
    Plko 1 Puro Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 puro control shctrl/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    plko 1 puro control shctrl - by Bioz Stars, 2026-06
    96/100 stars
      Buy from Supplier

    Image Search Results


    Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against luciferase or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of SMMC7721-shCtrl cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.

    Journal: Frontiers in Oncology

    Article Title: An inflammation-related gene landscape predicts prognosis and response to immunotherapy in virus-associated hepatocellular carcinoma

    doi: 10.3389/fonc.2023.1118152

    Figure Lengend Snippet: Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against luciferase or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of SMMC7721-shCtrl cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.

    Article Snippet: Full-length SLC7A2 cDNA was synthesized and cloned into the pCS-CG vector (Addgene, Cambridge, MA, USA). shRNA sequences specifically against CCL20 (shCCL20) and control-shRNA against luciferase (shCtrl) were expressed from pLKO.1-puro (Addgene, Cambridge, MA, USA).

    Techniques: Biomarker Discovery, Expressing, Quantitative RT-PCR, Western Blot, Reverse Transcription Polymerase Chain Reaction, shRNA, Luciferase, Knockdown, Over Expression, Injection, Transfection